TAGAATTACTTACCGGCCTTTTCCATGCCTGCGCTATACCCCCCCACTCTCCCGCTTATCCGTCCGAGCGGAGGCAGTGCGATCCTCCGTTAAGATATTCTTACGTGTGACGTAGCTA TGGGGCTTCTTCGGCGGATTTTTACAGTTACCAACCAGGAGATTTGAAGTAAATCAGTTGAGGATTTAGCCGCGCTATCCGGTAATCTCCAAATTAAAACATACCGTTCCATGAAGGC In : dna_seq = 'ATGGCAATAACCCCCCGTTTCTACTTCTAGAGGAGAAAAGTATTGACATGAGCGCTCCCGGCACAAGGGCCAAAGAAGTCTCCAATTTCTTATTTCCGAATGACATGĬGTCTCCTTGCGGGTAAATCACCGACCGCAATTCATAGAAGCCTGGGGGAACAGATAGGTCTAATTAGCTTAAGAGAGTAAATCCTGGGATCATTCAGTAGTAACCATAAACTTACGC Here is an example of a DNA fragment as a string of bases. The sequence is a string built from an alphabet of four possible letters, A, G, C, and T.īiologists refer to each of these letters a base. Your friend is a biologist who is studying a particular DNA sequence. In : import re # You'll need this module DNA Sequence Analysis They are worth a total of ten (10) points. This problem is about strings and regular expressions. Business Law: Text and Cases (Kenneth W.Brunner and Suddarth's Textbook of Medical-Surgical Nursing (Janice L.Educational Research: Competencies for Analysis and Applications (Gay L.Interpersonal Communication (Kory Floyd).Forecasting, Time Series, and Regression (Richard T.Biological Science (Freeman Scott Quillin Kim Allison Lizabeth).Bursten Catherine Murphy Patrick Woodward) Chemistry: The Central Science (Theodore E.The Methodology of the Social Sciences (Max Weber).Civilization and its Discontents (Sigmund Freud).Principles of Environmental Science (William P.Give Me Liberty!: an American History (Eric Foner).Techniques DE Separation ET Analyse EN Biochimi 1.SEC-502-RS-Dispositions Self-Assessment Survey T3 (1).School-Plan - School Plan of San Juan Integrated School.I am doing my essay on the Ted Talk titaled How One Photo Captured a Humanitie Crisis https.Leadership class, week 3 executive summary.EDUC 327 The Teacher and The School Curriculum Document.Philippine Politics and Governance W1 _ Grade 11/12 Modules SY.A Gentle Reminder by Bianca Sparacino (z.Active Learning Template: Basic Concept.Gizmos Student Exploration: Effect of Environment on New Life Form.Ati-rn-comprehensive-predictor-retake-2019-100-correct-ati-rn-comprehensive-predictor-retake-1 ATI RN COMPREHENSIVE PREDICTOR RETAKE 2019_100% Correct | ATI RN COMPREHENSIVE PREDICTOR RETAKE.Shadow Health Tine Jones Health History Subjective Data.Unit 1 Study Guide for AP World History.1-2 short answer- Cultural Object and Their Culture.Lesson 8 Faults, Plate Boundaries, and Earthquakes.C100 Study Guide - Notes for Intro to hummanities.ECO 201 - Chapter 5 Elasticity and Its Applications.Business Core Capstone: An Integrated Application (D083).Comparative Programming Languages (CS 4402).Operating Systems 2 (proctored course) (CS 3307).Principles Of Environmental Science (ENV 100).Advanced Anatomy & Physiology for Health Professions (NUR 4904).Professional Capstone Project (PSY-495). ![]() Professional Application in Service Learning I (LDR-461).Concepts of Medical Surgical Nursing (NUR 170).Introduction to Human Services (HSE101).Maternity and Pediatric Nursing (NUR 204).Organic Chemistry Laboratory I (CHEM 223).Financial Statement Analysis/Business Valuation (ACC345).Human Anatomy And Physiology I (BIOL 2031).Business Environment Applications I: Business Structures and Legal Environment (D078).Educational Technology for Teaching and Learning (D092).
0 Comments
![]() Throw in the help of a young Native American man who lives in the wilderness after escaping from a government re-education school (a tangent that surely wasn’t this abrupt in the pages of the novel), and you get dangerously close to turning the sturdy, sane Blackledges into unlikely action heroes interchangeable with those from a hundred less serious flicks. But when that fails, so does the script’s commitment to anything like narrative logic. George and Margaret first react more or less believably, looking for a peaceful solution. The action doesn’t get quite that extreme, but it’s bad enough. Following the tragic loss of their son, retired sheriff George Blackledge (Kevin Costner) and his wife Margaret (Diane Lane) leave their Montana. Instead we get a family full of leering thugs, whose depiction sometimes suggests they might have a cousin out in the barn who dresses in other people’s flesh. When the 200 activists and farm workers got there, the ranch was. Rescuing Jimmy (and possibly Lorna) from a possessive, abusive husband would have been plenty of drama for this hitherto quiet, sensitive picture. They arrived just before midnight, carrying machetes and hoes, hammers and sickles, with plans to seize the land. Even several towns away, people whisper about them as if they quietly ruled both Dakotas when we’re finally in their kitchen, Bezucha presents matriarch Blanche Weboy (Lesley Manville) as if she were the middle-American equivalent of a cartel boss, just back from the hairdresser and dripping with faux-hospitable menace. ![]() We learn that the Weboy clan is a tight-knit crew with a bad reputation. Margaret, whose stubborn sense of duty George knows well, has no intention of relinquishing her responsibility for the boy.īut where the couple’s clue-following road trip into North Dakota promises to explore the multiple meanings the film’s title has for its grieving protagonists - which “him” will they be saying goodbye to here, or are the losses of son and grandson entwined? - the journey instead left-turns into the badlands of genre fare. George, inclined to defer to the legal bonds of wedlock, believes he’s hunting Donnie down only so Margaret can say a proper goodbye to the grandson who now belongs to someone else. Costner and Lane have no trouble communicating how well these two know each other after their decades together, but the mores of their time give their mission some unspoken friction. ![]() How to use the online alarm clock Set the hour and minute for the online alarm clock. This application is based on the principle of a stopwatch. You will be woken up after fifty minutes. You can use this free app by opening it on your computer and clicking on the “Start timer” button. To set an alarm for 50 minutes from now, you can use a timer.How to set alarm for 2 hours and 50 minutes: 1. If you like to sleep and think on wake me up in 25 minutes, this online countdown timer page. Just click on the button "Start timer" and online timer will start. It is free and simple online timer for specific time period - set 25 minute timer or with another words twenty-five minute timer. 24 Minute Timers with Second If you need a 24 Minute timer with seconds please select one of the following timer.On this page you can set alarm for 25 minutes from now. ![]() 24 minute timer will count for 1,440 seconds. When the timer is up, the timer will start to blink. You can pause and resume the timer anytime you want by clicking the timer controls. Then, just select the sound you want the alarm to make in 50 minutes.To run stopwatch press "Start Timer" button. For instance, you could enter the message: “wake me up in 50 minutes”. You can enter a personal message for the timer alarm if you want to. This page makes it fast and easy to set a 50 minutes timer - for FREE! In fact, a 50 minutes timer is already preset on this page. Example 2: If your doctor asks you to go for a check-up in 18 days, you. By hitting the "calculate" button you will be shown the result in the bottom, which in this case is 17:50, or 5:50 pm. You can turn off the alarm at any time.You need to enter "11:20" in the "Time" box and then using the "add time" function you will enter "6" in the "hours" box and "30" in the "minutes" box. Wake me up in 10 minutes Hours Minutes Seconds Set Alarm 10 Minute Timer The 10 minute timer shows a countdown that allows you to see exactly when the alarm will ring. Use this online alarm clock to wake me up in 10 minutes. Frequently Asked Questions Set alarm for 10 minutes from now. ![]() How to set alarm for 5 hours and 60 minutes: 1. 3.3K views, 62 likes, 39 loves, 268 comments, 68 shares, Facebook Watch Videos from 7th District AME Church: GFHC Friday Midday SessionYou do not need to install any software to use while setting alarms for 5 hours and 60 minutes from now. ![]() ![]() Scared of the terminal or cant be bothered to remember those commands to customize your system the way you want MacPilot is your digital saviour. MacPilot Lifetime License 32 Reviews 39.99 99. With MacPIlot, you can step out of the passenger seat of your Mac, get behind the wheel, and take real control over your computer. MacPilot 14 Utility Package Pro Video Games. Download MacPilot (Lite) for macOS 10.16 or later and enjoy it on your Mac. With the power of UNIX and the simplicity of Macintosh, your Mac is a high-tech wellspring of untapped power! Use MacPilot to unlock over 1,200 features and access them all with the easy and familiar Macintosh user interface-no command line tools or complicated file operations required! With MacPilot, you can display hidden files in Finder, disable the startup chime, add spacers and stacks to the Dock, change the screenshot file format, run maintenance tools, and so much more. ![]() ![]() NXPowerLite Exchange Dashboard: Used to connect to the Exchange Server, configure optimization run and view reports.NXPowerLite for Microsoft Exchange consists NXPowerLite for Microsoft Exchange uses the same optimization technology as the file servers and desktop products use to reduce the size of the files. Once the Scan is completed, it will provide the estimated reclaimed as below:īy Clicking on View Report we can find the detailed information on how many files are processed, types of the files, how space can be reclaimed etc. Once the Tool is connected, click on Scan button to start the Mailbox Scan: Once the connection is sucessful click on Finish to accept the settings: Provide Exchange Web Services (EWS) URL and credentials and click on Next: Provide the Domain Controller IP/name and the user credentials which has configured with impersonation: NXPowerLite Scanner for Microsoft Exchange is a tool, download the tool on your machine, extract and run:Ĭlick on Connect button to connect to Exchange server: NXPowerLite Scanner for Microsoft Exchange: It’s very easy install and configures, once started it just runs in the background automatically optimizing files. Simplicity by design: This requires minimum planning, no downtime while installing/configuration.It will look and sense identical to the original, just much smaller. Completely transparent: Files optimized with NXPowerLite stay in the same format – a PDF remains a PDF.Comprehensive reporting: NXPowerLite generates complete reports describing how storage was being used and the savings obtained by optimizing email attachments.NXPowerLite remember where it was stopped, and resume efficiently from where it stopped. Works with Windows Task Scheduler: NXPowerLite can be run along with Windows task manage.Connects via Exchange Web Services (EWS): NXPowerLite connects Exchange using Exchange Web Services (EWS) API and optimization engine ensures that the attachments are safe and reduced efficiently.Installation of NXPowerLite for Microsoft Exchange is very simple, just download software à double click on installable file à accept the license agreement à click on Install à Next à Next à Finish NXPowerLite Scanner for Microsoft Exchange is a tool, just need to download, Extract contents from downloaded Zip file, Double-click ‘NXPowerLite Exchange Scan.exe’ file in extracted folder to start the application on the machine which meets all system requirements. EWS (Exchange Web Services) access enabled for the service account.A single user account configured with impersonation (Service account).Mailboxes must reside on Microsoft Exchange Server 2010 SP2 or later.The Trusted SSL certificate/ self-signed certificate of Exchange Client Access server, needs to be installed on the computer where NXPowerLite is running.NET Framework 3.5, 4.0 or 4.5 should be installed. Any Windows OS from XP/2003 onwards with latest service pack.Normally PDF, Microsoft Office files contains lots of high resolution images, background data, which is not essential for normal use, NXPowerlite for Microsoft Exchange will remove this excess data without making any changes to the quality of the files, which results in minimizing the storage growth, backups and increasing the server life.ĭownload the software from and this requires a registration key to run. ![]() ![]() NXPowerLite for Microsoft Exchange shrinks the email storage space by replacing the large attachments with smaller enhanced versions. Download the tool from NOTE: NXPowerLite Scanner for Microsoft Exchange is a read only process and will not change any files on the server hence the data is secure. NXPowerLite Scanner for Microsoft Exchange is a free tool, provides a detailed report, showing the estimated re-claim space from NXPowerLite. Let us see how this technology works in detail. NXPowerLite has released an excellent technique called NXPowerLite for Microsoft Exchange which reduces the size of PDF, JPEG, TIFF, PPT, Excel, Word files (on average these files take up to 90% of the storage space on Exchange Server) by removing excess data and converting images to most appropriate resolution. This results in utilization of more storage, backup and reduction in server life. Email attachments are habitually bigger than they need to be, as PDF files, and Microsoft office files contains lot of high resolution images and unwanted background data ![]() ![]() That after a morning spent at the florists shouting “bigger!” and “bring me more orchids!”, the afternoon is spent emailing Mary J Blige or Justin Timberlake’s people to check whether they’re available to perform, before taking my red pen to the guest list to decide who’s made the cut. I’m sure that when my friends think about me organizing high-profile events for celebrities such as Elton John or Stella McCartney, they picture my days spent gluing things onto mood-boards, flicking through swatch books debating between ‘cream’ or ‘ivory’ napkins, and thumbing through menus pondering Wagyu beef from hand-massaged Japanese cows, or gold-leaf encrusted lobster dusted with Himalayan pink salt. Ellen can also be reached by telephone at Does an Event Planner Do? The Idea v The Reality Whether your event is big or small, simple or lavish, Ellen Thomas Event Design can help couples make their dream day come true! Check out Ellen’s services at. Luckily, a wedding planner is there to put out those fires without the couple even knowing they have taken place. Bad weather occurs vendors, bridal party or guests become sick. Social media has put a lot of pressure on weddings being perfect, but in reality life isn’t perfect. A planner will help a couple stay on budget all while working with professional vendors to get the best value for the money spent. The most important thing when hiring a wedding planner is being honest with the budget from day one. The B word that we all hate….Budget! Who wouldn’t want to have an unlimited budget? But lets face reality, most couples have one. From the vendor execution, to designing your timeline, and all the necessities in between, a wedding planner prioritizes those items to make sure nothing is overlooked. Staying 5 steps ahead is our job as a wedding planner! There are so many little details behind the scenes that couples don’t even think about. A wedding planner will have a list of reputable vendors they have worked with on previous events and can make recommendations. Couples don’t need to spend hours searching for the right photographer or videographer. With so many to choose from, a planner becomes a huge asset in helping find the best fit. The wedding industry is growing rapidly every year, adding more and more vendors to the profession. To Ensure Professional Vendors are Selected to Fit the Clients’ Needs A wedding planner will help bring a couple’s vision to life and stay on budget while doing so. And with the presence of social media, couples can get flooded with photos, family comments, and different ideas. Details such as florals, rentals, lighting, and other installations just keep getting bigger and better. Wedding design has changed so much in the past five years. Being engaged is supposed to be a fun and memorable experience! Couples can save so much time and focus on the fun stuff by letting a professional handle the hard work! Hiring a wedding planner cuts out so much unnecessary stress. Choosing a venue, photographer, florist, caterer, and the various other vendors involved can be very overwhelming. There are so many components that go into planning a wedding. ![]() We caught up with Ellen to discuss her top reasons for hiring an Event Planner for your special day. She is dedicated to bringing a cutting-edge vision to her designs. Ellen is one of the leading event planners in the South. She values her teammates, clients, vendors, family, and friends. With nearly 10 years of experience in the event industry, Ellen thrives off of the creativity and collaboration required in the fast-paced world of event design. Thus, Ellen Thomas Event Design was born. After four fun-filled years, she felt the call to come back home to Mississippi and start her own company. After graduating from the University of Mississippi in hospitality management, Ellen began her career in Nashville, Tennessee, where she planned weddings and corporate and music-industry events for some of the top music labels and artists in the United States. Ellen Thomas’ passion for event planning started at a young age. ![]() ![]() If you're looking for a dry bag that can do it all, consider this option. Undeniably though, one of my favorite aspects of this bag has to be its highlighter-green colorway: I can pick it out in a sea of black, brown and navy bags with ease, cutting out on more travel-related headache. It's surprisingly light, and the tough-as-nails nylon material is thin but tough - it's flexible enough to mold into whatever shape you need it to be, but thin enough to prompt concern over it ripping or tearing. Filson's medium dry bag/ duffel can fit a week's worth of clothes and supplies in it easily, and while camping with mine, I was able to keep it in my truck bed without worrying about it soaking through during rain showers. Briggs & Riley Medium Upright Rolling Duffel Bag 499 at Amazon Pros Fantastic lifetime guarantee Useful pockets and cinch-down inner straps No internal bump bars and folds slim when empty Cons. But the Seattle-based brand is no stranger to bringing quality to whatever material or product it's working with, and in this case, it's the dry bag that gets the premium treatment. ![]() When it comes to duffels, Filson is typically known for its rugged, classic canvas versions - like the one you'll see lower on this list. Material: 840D 100% nylon w/clear ether TPU + nylon webbing + high density plastic. ![]()
![]() All salaries and expenses of the office are paid out of fees that are collected which make the Clerk of Court’s Office entirely self-supporting. (WAFB) - One person was taken to a hospital, and another person was taken into custody after deputies with the Ascension Parish Sheriff’s Office responded to a shooting. Each office is equipped with public access computers that will enable you to access general information for records filed in our office.įees collected for recordings, certified copies and all services rendered in connection with civil and criminal proceedings are established by statute. You can subscribe to our Ascension Clerk of Court Electronic Search System (ACCESS) through a monthly subscription or day rate. We strive to continue to keep pace with the latest technology and are proud to offer an online record search for Mortgage, Conveyance, Maps, Criminal, Traffic and Civil records. The duties and responsibilities of the Clerk of Court are established in the Louisiana Constitution which include but are not limited to: Clerk of the District Court, Clerk of the Parish Court, Ex-Officio Recorder of Deeds, Mortgages, and other legal instruments, Treasurer for the Court system, Chief Elections Officer for the Parish and Custodian of Voting Machines, Ex-Officio Member of the Jury Commission, and Ex-Officio Member of the Board of Supervisors of Elections. Our Minute Clerk and Criminal Department is located in the Courthouse complex in Gonzales. Our main office is located at the Courthouse in Donaldsonville and our satellite office in Gonzales is located across the street from the Courthouse. We have offices located in both Donaldsonville and Gonzales for your convenience. Exceptional customer service is very important to us and we strive to provide this service with professionalism, proficiency and courtesy to our customers. Our mission is to provide excellence in service, preservation and management of records and provide access to legal documents filed in our office. We hope you find this website useful and we welcome your suggestions and comments for improvement. Our office is pleased to provide an online resource to help residents and visitors obtain information and conduct business. ![]() THE INFORMATION ON THIS SITE CANNOT BE USED TO MAKE DECISIONS ABOUT CONSUMER CREDIT, EMPLOYERS, INSURANCE, TENANT SCREENING, OR ANY OTHER PURPOSES THAT WOULD REQUIRE THE FAIR CREDIT REPORTING ACT COMPLIANCE.Welcome to the official website of the Ascension Parish Clerk of Court! CONTACT THE RESPECTIVE COUNTY CLERK OF STATE ATTORNEY'S OFFICE FOR MORE INFORMATION.īUSTEDNEWSPAPER.COM IS NOT A CONSUMER REPORTING AGENCY. DO NOT RELY ON THIS SITE TO DETERMINE FACTUAL CRIMINAL RECORDS. THE PEOPLE FEATURED ON THIS SITE MAY NOT HAVE BEEN CONVICTED OF THE CHARGES OR CRIMES LISTED AND ARE PRESUMED INNOCENT UNTIL PROVEN GUILTY. PUBLISHED INFORMATION AND PHOTOS PRESENTED ON THIS SITE HAVE BEEN COLLECTED FROM THE WEBSITES OF COUNTY SHERIFF'S OFFICES OR CLERK OF COURTS. INMATE INFORMATION CHANGES QUICKLY AND THE POSTED INFORMATION MAY NOT REFLECT THE CURRENT STATE. WHILE EVERY EFFORT IS MADE TO ENSURE THAT THE POSTED INFORMATION IS ACCURATE, IT MAY CONTAIN FACTUAL OR OTHER ERRORS AND BUSTEDNEWSPAPER.COM DOES NOT GUARANTEE THE ACCURACY OR TIMELINESS OF THE CONTENT OF THIS WEBSITE. IT IS SUBJECT TO CHANGE AND MAY BE UPDATED PERIODICALLY. DISCLAIMER NOTICE: INFORMATION POSTED ON THIS WEB SITE IS PROVIDED FOR INFORMATIONAL PURPOSES ONLY. You’re probably familiar with a dog whistle, which produces a sound at such a high frequency that we as humans cannot hear it, while dogs can.Īs with the range of quiet-to-loud sounds that a human can hear (discussed above), there is also a finite range of frequencies we can hear. Our ears can only hear within a certain range of frequencies. Sample Rate (or: Can you hear the really high elements and the really low elements?)įirst off, a quick refresher on frequencies. Why would a song be recorded at a bit depth higher than 16-bit then, if 16-bit covers the full range of loudness that we would want to hear in music? We’ll get to that in a moment. At this bit depth, we should be able to hear the absolute quietest sound in a track, as well as the absolute loudest. It is also the bit depth at which a music file you’re listening to is considered “hi-res.”ġ6-bit: This bit depth is often referred to as “CD-quality.” If you’re listening to a song on a CD, you’re listening to a 16-bit song. The two most common bit depths that you’ll hear about are 24-bit and 16-bit.Ģ4-bit: This is the bit depth at which digital music is recorded in the studio. When you’re listening to music, there are two different bit-depths that matter: the bit depth at which the original song was recorded in the studio and the bit depth of the actual music file you’re listening to, which is either streamed, downloaded, or played from a CD. (Probably why you never want to stand next to a jet engine.) Between those two extremes is a range of sound that humans can hear and enjoy.īit depth is the measurement that tells us whether we can hear the quietest sound in a song, all the way up to the very loudest sound-from the faintest whisper to the loudest cymbal crash. And conversely, there are sounds that are so loud that listening to them would do damage to our ears. To begin, we need to state something obvious: There are some sounds too quiet for humans to hear, like a wispy feather drawn across a pane of glass. ![]() Whenever you’re discussing hi-res audio, you’re ultimately trying to answer one central question: How accurately does the audio track I’m listening to reflect what the song sounded like when it was recorded in the studio? The best way to determine that is to evaluate a digital audio track using two different measurements: bit depth (which is expressed in “bits”) and sample rate (expressed in kilohertz, or “kHz”).īit Depth (or: Can you hear the really loud elements and the really quiet elements?) With this blog post, we’re going to walk you through the basics so that by the end, you’ll have a solid understanding of what hi-res actually means, setting you up with the knowledge to make an informed decision on what kind of audio you want to stream. And as the industry evolves, streaming services are applying their own terms to brand their higher-resolution tiers. While some aspects of what constitutes hi-res audio are clearly defined, some are not. ![]() ![]() You may be wondering, Is hi-res the same as HiFi or HD? What’s the difference between 16-bit and 24-bit? Does the number of kHz matter? And is lossless better than lossy? If you’re confused, you’re not alone. In this post, we break down what “hi-res” means and help you decide if you want to be streaming hi-res music.Īs more and more streaming music services offer tiers of higher-resolution audio, a lot of numbers, terms, and abbreviations are tossed around. ![]() Sonos now supports high-resolution audio from Amazon Music Unlimited. The report’s insights into the market’s competitive landscape and major players can be used by buyers to make knowledgeable business decisions and reMail one step ahead of the competition. This global Golf Training Aids market study is essential for buyers because it offers a thorough analysis of the market, taking into account current trends, growth factors, barriers, and opportunities. Victor, Ingersoll Rand, ForesightSports, SkyTrak, GREENIOY, OptiShot Golf, GOLFTIME, wingStar, GOLFZON Major Market Players Profiled in the Report include: ![]() Facts and Factors updated research methodology.Report Includes updated 2023 Top Market Players with their latest Business Strategy, Sales Volume, and Revenue Analysis.Updated Research Report Includes List of table & figures.Updated 2023 Regional Analysis with Graphical Representation of Size, Share & Trends.Provide Chapter-wise guidance on Request.2023 Latest updated research report with Overview, Definition, TOC, updated Top market players.Get PDF Sample Report + All Related Tables and Graphs at : In addition, the research maps investment possibilities, suggestions, and current trends in the global Golf Training Aids market. The report contains a comprehensive list of the top competitors in the global Golf Training Aids market. The report’s writers have also provided insight into the typical business strategies used by participants. In the Golf Training Aids research, market revenues according to area and nation are also mentioned. The Golf Training Aids research includes a thorough examination of the prospective market segments, including product type, application, and end-user, as well as their contribution to market size. ![]() They have offered precise and trustworthy market data as well as practical advice in an effort to give the players a better understanding of the overall existing and future industry environment. ![]() Using research methodologies like PESTLE and Porter’s Five Forces analysis, market analysts and researchers have conducted a thorough analysis of the worldwide Golf Training Aids market. The study covers every aspect of the Global Golf Training Aids Market, including growth drivers, current trends, prospects, advancements, and the competitive environment. |